Inventions in Enzyme category
Introduction
Enzyme is one of those areas that honestly has a lot of new inventions coming up almost every day. Of course, quality is more important than quantity but dont' forget about the element of chance. In higher sample size there is that higher probablity of somethign useful coming up.
Patented Inventions in Enzyme
-
Secreted and transmembrane polypeptides and nucleic acids encoding the same
Here are few examples in this category: A Secreted and transmembrane polypeptides and nucleic acids encoding the same, which seems to be dated Tue, 13 Aug 2002 00:00:00 -0700. This one is quite interesting for Enzyme category. First of all it is very futuristic; I guess everything new that is invented has to be in one way or another futuristic. Anyways, the point here is that this invention has some good potential for future. Inventors of this project were Genentech, Inc.. The idea behind the it is very odd in a good way.
Let’s say see what the actual authors say about them: 61 132), FIG. 134 (SEQ ID NO: 134), FIG. 136 (SEQ ID NO: 136), FIG. 138 (SEQ ID NO: 138), FIG. 140 (SEQ ID NO: 140), FIG. 142 (SEQ ID NO: 142), FIG..
Here is its drawing
-
Nucleic acids, proteins, and antibodies
Here are few examples in this category: A Nucleic acids, proteins, and antibodies, which seems to be dated Fri, 26 Jul 2002 00:00:00 -0700. This one is quite interesting for Enzyme category. First of all it is very futuristic; I guess everything new that is invented has to be in one way or another futuristic. Anyways, the point here is that this invention has some good potential for future. Inventors of this project were Human Genome Sciences, Inc.. The idea behind the it is very odd in a good way.
Let’s say see what the actual authors say about them: ... [0086] In specific embodiments, polynucleotides of the invention comprise, or alternatively consist of, a polynucleotide sequence in which the 3' 10 ....
Here is its drawing
-
Nucleic acids encoding endotheliases, endotheliases and uses thereof
Here are few examples in this category: A Nucleic acids encoding endotheliases, endotheliases and uses thereof, which seems to be dated Mon, 20 Nov 2000 00:00:00 -0800. This one is quite interesting for Enzyme category. First of all it is very futuristic; I guess everything new that is invented has to be in one way or another futuristic. Anyways, the point here is that this invention has some good potential for future. Inventors of this project were Dendreon Corporation. The idea behind the it is very odd in a good way.
Let’s say see what the actual authors say about them: 97 98 -continued cctgccagat ggactgcttc ctttg 25 <210> SEQ ID NO 8 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> ....
Here is its drawing
-
Secreted and transmembrane polypeptides and nucleic acids encoding the same
Here are few examples in this category: A Secreted and transmembrane polypeptides and nucleic acids encoding the same, which seems to be dated Thu, 12 Sep 2002 00:00:00 -0700. This one is quite interesting for Enzyme category. First of all it is very futuristic; I guess everything new that is invented has to be in one way or another futuristic. Anyways, the point here is that this invention has some good potential for future. Inventors of this project were Genentech, Inc.. The idea behind the it is very odd in a good way.
Let’s say see what the actual authors say about them: ... 7 GGGAACGGAAAATGGCGCCTCACGGCCCGGGTAGTCTTACGACCCTGGTGCCCTGGGCTGCCGCCCTGCTCCTC GCTCTGGGCGTGGAAAGGGCTCTGGCGCTACCCGAGATATGCACCCAATGTCCAGGGAGCGTGCAAAATTTGTC ....
Here is its drawing
Recent Coding Future Posts:
Here are couple of things you never heard of Google glasses and Holoflector. These are I would say the first important step towards viable augmented reality future. They are from rival companies Google and Microsoft. Without further ado,:
...MoreWhat future technology would you like to have today ? If Aladdin’s jenni gave you three wishes, what would be your wishes? Here is my list: 1. Super brain Yes, I wan to be able to read and absorb the entire content of internet in light speed. In fact, I want to be the internet. Sounds too far [...]
...MoreAre you up for a quiet little ice age? Then pack your bags, based on recent observations, in our near future, we might have one. It seems like our Sun is about to become quiet. Not forever though, just for a while its activity will be lower. A little explanation: To most of us sun is a [...]
...MoreDon’t know what these words are? Soon you will have to memorize them, that is if you really want to know all periodic elements by heart. It seems like after three years of review our beloved chemists and physicists finally decided that they will be adding element 114 and 116 to the periodic table of [...]
...MoreIn 2009 Apple purchased Lala, a cloud based music service. After that everybody has been waiting for the day when Apple does something with it. Today is the day. They have announced the iCloud. Hold on to your paints, it is music in the clouds, and best of all it is FREE (yes they announced [...]
...MoreSearching inventions by utalizing United States Patent classification and Google patent search.
More Invention Categories :
Search Categories:Next>>