Inventions in Fungi Compositions Protein Extracts From category

Introduction

Fungi Compositions Protein Extracts From is one of those areas that honestly has a lot of new inventions coming up almost every day. Of course, quality is more important than quantity but dont' forget about the element of chance. In higher sample size there is that higher probablity of somethign useful coming up.

Patented Inventions in Fungi Compositions Protein Extracts From

  1. Polypeptides having Cellulolytic Enhancing Activity and Polynucleotides ...

    Here are few examples in this category: A Polypeptides having Cellulolytic Enhancing Activity and Polynucleotides ..., which seems to be dated Wed, 17 Dec 2008 00:00:00 -0800. This one is quite interesting for Fungi Compositions Protein Extracts From category. First of all it is very futuristic; I guess everything new that is invented has to be in one way or another futuristic. Anyways, the point here is that this invention has some good potential for future. Inventors of this project were . The idea behind the it is very odd in a good way.

    Let’s say see what the actual authors say about them: 101 1. An isolated polypeptide having cellulolytic enhancing activity, selected from the group consisting of: (a) a polypeptide comprising an amino acid ....

    Here is its drawing Polypeptides having Cellulolytic Enhancing Activity and Polynucleotides ...

  3. Polypeptide from a cellulolytic fungus having cellulolytic enhancing activity

    Here are few examples in this category: A Polypeptide from a cellulolytic fungus having cellulolytic enhancing activity, which seems to be dated Fri, 28 Jan 2005 00:00:00 -0800. This one is quite interesting for Fungi Compositions Protein Extracts From category. First of all it is very futuristic; I guess everything new that is invented has to be in one way or another futuristic. Anyways, the point here is that this invention has some good potential for future. Inventors of this project were Novozymes, Inc.. The idea behind the it is very odd in a good way.

    Let’s say see what the actual authors say about them: ... 80 MRFDALSALAL CGCCGCTTGTGGCTGGCCACGGCGCCGTGACCAGCTACATCATCGGCGGCAAAACCTATCCCGGCTACGAGGGCTTCTCG 160 APLVAG HGAVTSYIIGGKTYPGYEGFS ....

    Here is its drawing Polypeptide from a cellulolytic fungus having cellulolytic enhancing activity

  5. Identification And Use Of Genes Encoding Amatoxin And Phallotoxin

    Here are few examples in this category: A Identification And Use Of Genes Encoding Amatoxin And Phallotoxin, which seems to be dated Mon, 10 Nov 2008 00:00:00 -0800. This one is quite interesting for Fungi Compositions Protein Extracts From category. First of all it is very futuristic; I guess everything new that is invented has to be in one way or another futuristic. Anyways, the point here is that this invention has some good potential for future. Inventors of this project were . The idea behind the it is very odd in a good way.

    Let’s say see what the actual authors say about them: 181 -continued <400> SEQUENCE: 464 Gly Gly Asp Tyr Ser Thr lie Tyr Val Arg Ser Thr Ser Ser Pro Leu 15 10 15 Ser Gin Ser Ser Val Ala Gin Gly Val Asp Gly Arg ....

    Here is its drawing Identification And Use Of Genes Encoding Amatoxin And Phallotoxin

  7. Antitumorigenic protein, method of preparing it and antitumorigenic ...

    Here are few examples in this category: A Antitumorigenic protein, method of preparing it and antitumorigenic ..., which seems to be dated Fri, 22 Jan 1993 00:00:00 -0800. This one is quite interesting for Fungi Compositions Protein Extracts From category. First of all it is very futuristic; I guess everything new that is invented has to be in one way or another futuristic. Anyways, the point here is that this invention has some good potential for future. Inventors of this project were Director of National Food Research Institute, Ministry of Agriculture, Forestry and Fisheries, Momoya Co., Ltd.. The idea behind the it is very odd in a good way.

    Let’s say see what the actual authors say about them: Two-dimensional electrophoresis — , > 1st 6.5% Native-PAGE FIG.6 ....

    Here is its drawing Antitumorigenic protein, method of preparing it and antitumorigenic ...


Recent Coding Future Posts:


Google glasses and Holoflector, Augment your Reality

Here are couple of things you never heard of Google glasses and Holoflector. These are I would say the first important step towards viable augmented reality future. They are from rival companies Google and Microsoft. Without further ado,:

...More
Your Three Wishes For the Jenny

What future technology would you like to have today ? If Aladdin’s jenni gave you three wishes, what would  be your wishes? Here is my list: 1. Super brain Yes, I wan to be able to read and absorb the entire content of internet in light speed. In fact, I want to be the internet. Sounds too far [...]

...More
Sun Slowing , a Little Ice Age Coming

Are you up for a quiet little ice age?  Then pack your bags, based on recent observations, in our near future, we might have one. It seems like our Sun is about to become quiet. Not forever though, just for a while its activity will be lower. A little explanation: To most of us sun is a [...]

...More
Ununquadium and Ununhexium

Don’t know what these words are? Soon you will have to memorize them, that is if you really want to know all periodic elements by heart. It seems like after three years of review our beloved chemists and physicists finally decided that they will be adding element 114 and 116 to the periodic table of [...]

...More
iCloud is Out, and it is Free

In 2009 Apple purchased Lala, a cloud based music service. After that everybody has been waiting for the day when Apple does something with it. Today is the day. They have announced the iCloud. Hold on to your paints, it is music in the clouds, and best of all it is FREE (yes they announced [...]

...More

Searching inventions by utalizing United States Patent classification and Google patent search.

Loading...